الفهرس 
Review of LiteratureOnly 14 pages are availabe for public view
 |  | from | 74 |  |  |
| | | from | 74 | | |
Abstract
Colibacillosis is an economically important disease, which is
prevalent through the world. E.coli has been implicated in a variety of
disease conditions in poultry, such as colisepticaemia, coligranuloma, air
sacculitis, peritonitis, pericarditis, omphalitis and oophoritis, accounting for
about 5-50% mortality in poultry flocks, Margie et al. (1999).
This prospective practical laboratory study was carried out during the
period between September 2013 and March 2014 in the Microbiology
Department, Faculty of Medicine, Assiut University; and Molecular
Biology Research Unit, Assiut University. It aimed to isolate E.coli from
the liver, lung, and intestinal contents of chicken by conventional culture
method using two different selective media, to identify E.coli by using API
20 E system, establishing a specific, sensitive and rapid Polymerase Chain
Reaction (PCR) assay for the detection of E.coli and comparison among
conventional culture method, API20E and PCR for identification of E.coli.
For this reason a total numder of 150 organs (60 liver, 45 lung and 45
intestinal contents) of recently dead chickens that died due to acute
diarrhaea during several outbreaks in different farms at Assiut, Minea and
Sohag governorates.
Conventional methods demonstrated that out of 60 liver samples, the
isolates were positive (typical E.coli) in 38/60 (63.3%), and were negative
(atypical and non-typical E.coli) in 22/60 ( 36.67%). The isolates were
positive (typical E.coli) in 22/45 (48.89%) samples, and negative in 23/45
(51.11%) of a total 45 lung specimens. On the other hand, out of 45
intestinal samples, positive cultures (typical E.coli) were detected in 19/45
(42.2%) samples, and negative in 26/45 (57.78%). It had been shown that
the conventional methods for E.coli detection by culturing present serious
difficulties for standard selection. There is no general agreement
concerning determination of the gold standard for the detection of these
pathogens.
In the present study, the biochemical reactions were determined by
using the API 20 E system for only 25 isolated strains. The results obtained
by this system revealed that out of 10 typical E.coli colonies only 7 (28%)
were positive for E.coli i.e. the API 20E system confirmed the positivity of
only 7 (28%) typical E.coli colonies, while the other 3 (12%) were negative
by API 20 E system, and out of 10 atypical colonies 6 (24%) the API 20 E
system were positive for E.coli and 4 (16%) were negative, while out of the
5 non- typical colonies, API 20 E test revealed 3 (12%) were positive and 2
(8%) were negative. These results demonstrated the value of API 20 E test
in identifying the atypical and non-typical E.coli isolates and rising the
positivity of the negative E.coli isolates.
The results of PCR assay on DNA obtained from the yielded
cultures. The specific detection of the E. coli species was based on PCR
amplification of the 16S rRNA gene using oligonucleotide
primers, ECO-f GACCTCGGTTTAGTTCACAGA and ECO-r
CACACGCTGACGCTGACCA, whose PCR product size was 585 bp,
Photo (3), 10 colonies were taken for PCR assay, (3 typical colonies, 4
atypical colonies and 3 non-typical colonies), and the results were shown in
Table (6). Comparing the results of PCR and those of culture examination,
it was found that PCR could detect 3 positive culture of E.coli isolates , in
addition to 4 samples with atypical colonies and 3 samples of non-typical
colonies. These data indicated that the PCR has sensitivity of 100% greater
than that of cultural methods that has 52.67%. Comparing the results of
PCR and those of API 20E system, it was found that PCR could confirm
the positivity of 5 samples(2 typical, 2 atypical and 1 non- typical) positive
by API 20E, in addition to detecting the positivity of other 5 samples (1
typical, 2 atypical and 2 non-typical) negative by API 20E. These data
indicated that PCR has sensitivity of 100% compared to 64% for API 20E.
In conclusion, the present study showed that the PCR amplification
assay was not only highly sensitive, but also could provide a result on the
same day that a spicemen was submitted for evaluation , a potential
advantage during outbreak investigations, that provide specific, rapid,
simple and convenient test.