الفهرس 
ContentsOnly 14 pages are availabe for public view
 |  | from | 135 |  |  |
| | | from | 135 | | |
Abstract
Sarcocystis species is one of the most prevalent protozoal infections among domestic animals. Few studies involved the infection of the Egyptian sheep with these protozoa. So, this study was conducted to investigate the prevalence and distribution patterns of different Sarcocystis species infecting sheep slaughtered at 3 Egyptian Provinces (Dakahlia, Damietta and Cairo), for detection of Sarcocystis infection in addition to molecular characterization of that parasites. Herein, we examined 540 slaughtered sheep of different ages and sexes. Small pieces of meat specimens were cut, compressed between two glass slides and examined under the dissecting microscope using X10 magnification. Fast 5 minutes 10% Geimsa solution immersion of the fresh samples was performed for better observation of the microscopic sarcocysts. Moreover, formalin-buffered preserved samples were subjected to histopathological examination. The results showed that the overall incidence of Sarcocystis species cysts was 95.37%, where 515 / 540 sheep were found to be infected. Microscopic cysts were prevalent at higher rate (95.37%) than macroscopic cysts (0.74%), as all infected sheep were harboring microscopic cysts, while mixed infection with both microscopic and macroscopic cysts was detected in 0.74% of the examined sheep, where only 4 sheep were infected with both types of cysts. Concerning tissue distribution of recovered cysts, all esophageal samples were infected (95.37%), followed by diaphragm (66%) then, abdominal muscles (20%). Moreover, macroscopic cysts were detected only in esophageal muscles of sheep over 2 years old group (1%). Mixed infection of both diaphragm and esophagus was 6.11% while mixed infection of esophagus, diaphragm and abdominal muscles was 0.37%, where 33 and 2 sheep were found to be infected out of 540 examined, respectively. Concerning the prevalence of the revealed sarcocysts in different ages, higher infection rate was recorded in sheep over 2 years old (98.5%) than that of sheep less than 2 years old (86.43%). Regarding to relation between animal sex and the infection rate, the results of the present study showed that females were more infected (99%) than males (94.55%).Approaching the seasonal dynamics of sheep sarcocystosis in the present study, incidences equal to or over than 90% were reported in all seasons of the year. The incidence was observed to be increased during Spring (93.10%) to reach its maximum during Summer (96.95%), then decreased in Autumn (91.16%) to reach its lowest rate during Winter (84.72%).Concerning the morphological features of the revealed sarcocysts, Macroscopic cysts ranged from 0.8 – 1 cm in length (mean 0.9 cm, n = 7). They appeared as dull white, oval shaped cysts resembling rice grain. The cyst wall was thin and smooth ranging from 1.6 – 1.9 µm (mean 1.8 µm) and often surrounded by connective tissue as a secondary wall. Microscopic cysts ranged from 600 – 700 µm (mean 630 µm, n = 12) in length. They were oval shaped and the cyst wall was thick, measured 1 – 3 µm (mean 2.7 µm, n = 12). Their walls appeared either smooth or striated, With respect of the PCR reaction, genomic DNA of 40 samples of the parasite was extracted using RT-PCR using oligonucleotide primers to amplify specific DNA fragments 600-bp of 18S ribosomal RNA. An oligonucleotide primers sequence was Sar-F1 Forward 5’GCACTTGATGAATTCTGGCA3’ and Sar-R1 Reverse 5’CACCACCCATAGAATCAAG 3. The DNA fragments were separated on agarose gels electrophoresis. PCR products were purified for sequencing reaction. Purified RT-PCR products obtained from 10 bands derived from Sarcocystis species DNA were sequenced in the forward and reverse directions. Analysis of data was performing using BLAST 2.0 software were performed to establish sequence identity to Gen Bank accessions. The sequencing data revealed that Sarcocystis gigantea, genotyping of one tissue sample (sample1) was identical to accession numbers (KF489421 and KC209733 ) in gen bank. While Sarcocystis tenella, genotyping revealed three haplotype. The first haplotype was identical to accession numbers (KP263754, KP263752 and KP263758) in gen bank. While the second haplotype was identical to accession numbers (KP263759, KP263757 and KP263756) in gen bank but, the last haplotype was identical to accession numbers (KP263757 & KP263756) in gen bank.