الفهرس 
INTRODUCTIONOnly 14 pages are availabe for public view
 |  | from | 144 |  |  |
| | | from | 144 | | |
Abstract
DNA barcoding (a tool for rapid species identification based on DNA sequences) share an emphasis on large scale genetic data which give the accurate difference among species. DNA barcodes consists of a standardized short sequence of DNA (400-800 bp) that in principle should be easily generated and characterized for all species on the planet has been stablished to stimulate the creation of data base of documented and vouchered reference DNA sequences to serve as a library for undefined taxa. The current work was carried out in The Faculty of Agriculture, Agricultural Botany Department, Saba Basha, Alexandria University, Alexandria, Egypt during the period of 2019 to 2021 to study morphological description and accurate taxonomical identification of some Legume tree species grown in Egypt by applying plant genetic barcoding
Therefore, this proposed research is scrutinized to barcode some legume trees plants distributed in Egypt based on morphological and DNA barcode studies using rbcL and matK via the following steps:
1- Calculate the morphological characteristics of some traditional leguminous trees and their identification according to the different references in this field,
2- Extract the DNA from each species to do the genetic coding of the rbcL and matK genome of the plastid genomes.
3- Study the sequence of the nitrogenous bases of these genetic materials,
4- Alignment the current genetic sequence which obtained from NCBI and CBOL and matched the observed sequence with other in the GenBank,
6- Calculating the differential between the different types of trees using precise genetic coding instead of the phenotypic distinction,
7- Finding the evolutionary relationship between the types of these trees.
During the current study fifteen species were collected belonged to family fabacea from Antoniades Garden’s between July 2019 and January 2020 were Cassia fistula, Cassia javinca, Albizia lebbek, Delonix regia, Senna surattensis, Parkinsonia aculeata, Schotia brachypetala, Tipuana tipu, Erythrina humeana, Sophora secundiflora, Leucaena leucocephala, Enterolobium contortisiliquum, Dichrostachys cinerea, Acacia saligna and Dalbergia sissoo. All the morphological characters were detected based on previous publications, besides photographed all the plant species by the own authors Genomic DNA was extracted from fresh leaves tissue using i-genomic plant DNA extraction Mini kit @ iNtron Biotechnology according to the protocol associated with the Plant Genomic DNA Kit (iNtRON Bio Co., South Korea). PCR amplification was conducted by using Applied Biosystems® ProFlex™ PCR System. Two universal primers (matK –RbcL ) were designed by using the Basic Local Search tool (BLAST) by Primer3 program as RbcL F: ATGTCACCACAAACAGAGACTAAAGC; R: GTAAAATCAAGTCCACCRCG and MatK: F: CGTACAGTACTTTTGTGTTTACGAG; R: ACCCAGTCCATCTGGAAATCTTGGTTC and the data analysis was done for the One grouped dataset.